1. The Piltdown Hoax, which www.pbs.org refers to as one of the greatest hoaxes in the history of science, took place in a village named Piltdown in southeast England during the early twentieth century (around the start of the first World War). The pieces of the skull of the so-called "Piltdown man" were discovered in Piltdown by a worker who gave the fossil to an archaeologist named Charles Dawson. This fossil of the Piltdown man was deemed by Dawson and his colleague Sir Arthur Smith Woodward to be evidence of the first man (specifically, the first British man, which was extremely important at the time because of the nationalistic war excitement that was flaring up at the time). They believed that this fossil belonged to a creature that bridged the evolution from ape to man, which would have been quite spectacular if it were not greatly exaggerated. At the time, the scientific community viewed this discovery as a way of identifying how apes evolved into men, essentially proving Darwin's theory of evolution and validating years of research regarding evolution. But in 1953, it was discovered that the fossil was a hoax because it did not belong to the first man-evolved-from-ape, but rather it belonged to an orangutan that was only a few hundred years old. This discovery was made after the Natural History Museum performed a chemical test on the skull to test its legitimacy, only to find that it was artificially altered to appear as if it belonged to the first human-like creature. Scientists were embarrassed and disgusted at this lie, as many of them had spent decades believing in the validity of this skull; naturally, they did not appreciate being fooled, especially since this falsified discovery was of something that was considered to be the most influential knowledge regarding evolution that existed at the time.
2. The human faults that came into play in this scenario were potentially a mixture between pride, nationalism, and a desire to be acknowledged throughout history for a great and respectable deed. All people can be proud, but scientists are particularly so when they want to prove that their claims are accurate, which can only be done through scientific evidence. Additionally, because this incident occurred during the beginning stages of the first World War when England and Germany were at each others' throats, the people of England were obviously filled with a desire to be superior to their foes in any way, shape or form. By discovering that the first man was located in England, the British could boast to their German adversaries that their nation is superior (a very foolish basis for superiority I might add - just my two cents though). Finally, scientists are constantly attempting to establish a place in history by discovering something so momentous that they would be well-known throughout the world for as long as humans are alive and have knowledge of scientific discovery. This desire for individual achievement stems from the human desire to feel essential, which is perfectly natural for people to feel but does not belong in the world of science. These faults made it so that the scientists felt as if they absolutely needed to discover something enormous, which means that biases were involved in what should have been an objective scientific discovery.
3. The skull was discovered to be a fraud due to the chemical tests done at the Natural History Museum in England, which tested the fossil for its age as well as the specific species it belonged to. The test involved estimating the nitrogen content of the fossil to determine its age, which yielded the shocking result that it was only a few hundred years old and therefore could not have belonged to the first living man. Once they discovered that it was much younger than originally anticipated, the scientists at the museum checked to see if the pieces of the skull had been falsified through the use of chemicals, which it had been; this confirmed that the skull that was discovered was in fact a hoax and not legitimate.
4. I do not think it would be possible to remove the human element from science without removing humans altogether. If a group of machines were programmed to conduct scientific research, the results would be completely objective because the machines would have no other motives. But humans are always motivated by factors such as wealth, fame, and respect; scientists behave the same way. Unless scientists were unable to feel emotions and were filled solely with the desire to provide sound scientific research, there will always be a human factor in science. That said, if it were possible to remove this element from science I would definitely approve because it would ensure that scientific research is legitimate and is done purely for the sake of science. It would make science so much more accurate, which would allow discoveries and theories to develop much faster than they do with a human factor involved.
5. The important lesson to take from this incident is that evidence should not be accepted as truth until it has been reviewed and is proven to be legitimate, much like how theories are not accepted until they have been proven to be true through countless experiments. If a scientist claims that a discovery is legitimate, that does not establish the discovery as legitimate; it is essential for tests to be done to prove that the discovery is not a fraud, like the scenario with the Piltdown Man. Another lesson to learn is that scientists are humans and are not the ultimate authority of legitimacy on matters that occurred hundreds to billions of years in the past. It is foolish to take any one scientist's word on something as one hundred percent legitimate until the discovery or hypothesis has been validated by experimentation or testing.
Tuesday, September 23, 2014
Thursday, September 18, 2014
Comparative Primate Blog Post
Comparative
Primate Blog Post
In this blog post, I am going to be addressing the
five types of primates that are mentioned in the prompt. Under each type of primate, I will answer the
various questions asked about each type of primate so that these different types
can be compared.
1. Lemurs
Lemurs were once found in almost any tropical area
of the planet, but over time they greatly decreased in number and they now
reside primarily in the Old World on islands like Madagascar or the Comoro
Islands. They live in tropical
environments with lots of trees because their bodies allow them to excel at
climbing the branches of trees.
The locomotor pattern of lemurs is that they use all
four of their legs to climb, jump, run, etc. hence why they are known as
quadrupedals. Because of their tropical
environments that are filled with enormous trees, lemurs are benefited by using
all four of their limbs to move around quickly and potentially avoid danger
(which is especially important because they are an endangered species). (Source: http://www-personal.umich.edu/~phyl/anthro/prosimian.html)
2. Spider
Monkeys
Spider monkeys belong to a broader category of
monkeys known as New World monkeys, which primarily exist in tropical
environments in Mexico, Central America, and South America. Similarly to lemurs, spider monkeys spend
most of their lives living in the trees of these tropical environments. (Source: http://anthro.palomar.edu/primate/prim_5.htm)
Because spider monkeys are arboreal and live in
trees, they are primarily quadrupedals because it is easier to travel through
trees when using all four limbs (very similar to lemurs in this sense). However, they also can be classified as bipedals
because they only use two legs when leaping between trees, and they often
suspend from trees using their tails or individual limbs. Their environment made it so that they would
need to use all four limbs when moving because of the immense number of trees
in their habitats.
3. Baboons
Baboons reside in both the trees and
plains/grasslands of Africa (with some living in Southern and Eastern
Asia). They live in both types of
terrains which makes them semi-terrestrial primates. The land they live on can vary from tropical
forests to dry grasslands and anything in between. (Source: http://anthro.palomar.edu/primate/prim_6.htm)
As mentioned above, baboons are semi-terrestrial,
which means that they are quadrupedals when they live in the trees but are
bipedals when walking on land. Depending
on their environment, baboons use different modes of movement because they move
faster using different locomotion patterns in different places.
4. Gibbons
Gibbons exist almost
exclusively in Southeast Asia, where they live among trees as completely
arboreal apes; in fact, they rarely ever leave their homes in the tree tops.
(Source: http://anthro.palomar.edu/primate/prim_7.htm)
The locomotor pattern of gibbons is known as
suspensory climbing because they move around by swinging under branches using
distinct hand motions. Very rarely, when
gibbons walk on the top of branches or on the ground, they move bipedally
because they no longer need to swing from place to place. Again, the environment shapes the necessity
of the way gibbons move from place to place.
5. Chimpanzee
Chimps live mostly in African tropical forests and savannas,
where they can live in the trees or on the ground due to the flexibility of
their limbs. (Source: http://anthro.palomar.edu/primate/prim_7.htm)
The locomotion patterns of chimpanzees include both
quadrupedalism when they move on the ground and swinging when moving in the
trees. They are primarily quadrupedals
because they use their four limbs whenever they move regardless of where they
are.
In summary, the environment in which primates lives has an enormous effect on the way they move and live their lives. For primates such as lemurs or gibbons who live in areas with primarily trees surrounding them, for example, it becomes a necessity for them to use all of their limbs to move from place to place; however, chimps and baboons are found on land as well as in trees, so they must diversify the means by which they move about. The environment is ultimately responsible for the type of locomotor patterns that each type of primate uses in their natural habitats.
Friday, September 12, 2014
Homologous and Heterogous Traits
1. a. Two species that share a homologous trait and rely on the inheritance of a trait from ancestors could include human beings and other primates. Both humans and other primates have at least a tailbone (but many monkeys have full tails) which are related between different species. In the anatomy of primates, there is at least a tailbone present in humans and non-humans, which was inherited from the common ancestor shared between these two groups. So in short, humans have tail bones while other primates have tails or tail bones, and humans are related to other primates based on historic biologic connection.
b. In humans, the homologous trait being discussed is the tail bone, which is the located near the rectum in terms of its exterior location in the human anatomy. The tail bone, officially known as coccyx, is a useless bone in terms of function, but it is a sign that humans have evolved over the years from an ancestor that had a tail. Contrastingly, some primates possess tails where our tail bones are located, and these tails are an essential part of their lives and how they function. Over time, the lack of a need for a tail led humans to evolve so that they do not have tails, which in turn has left the coccyx as the only remnants of the tails that our ancestors once had. In contrast, other primates like monkeys still have tails because they need to use them to survive on a daily basis because of the environments they live in. Humans have evolved away from tails because of lack of necessity.
c. The common ancestor shared between humans and monkeys (and similar primates) is a type of primate that lived before humans existed. These two groups are within the same species of mammal, so their last closest link is fairly recent when compared to other animals with shared homologous traits.
d. Refer to pictures below
2. a. An example of an analogous trait would be fins, which exist on fish such as sharks as well as birds like penguins. These fins, which serve the same universal purpose, are not necessarily linked because the two species are related to one another directly.
b. The fins on birds like penguins allow the birds to move from place to place on icy surfaces, as they have to slide to travel and these fins increase their ability to do so. Fish use their fins to swim through water, so in this way both species use their fins as means of transformation. Both penguins and fish have these fins as their arms, meaning that they are vital to their survival in their respective environments.
c. I could not find a species that traced back to the relationship between penguins and fish, but evidently the species had to have had fins and obviously lived in a water environment.
d. Refer to picture
b. In humans, the homologous trait being discussed is the tail bone, which is the located near the rectum in terms of its exterior location in the human anatomy. The tail bone, officially known as coccyx, is a useless bone in terms of function, but it is a sign that humans have evolved over the years from an ancestor that had a tail. Contrastingly, some primates possess tails where our tail bones are located, and these tails are an essential part of their lives and how they function. Over time, the lack of a need for a tail led humans to evolve so that they do not have tails, which in turn has left the coccyx as the only remnants of the tails that our ancestors once had. In contrast, other primates like monkeys still have tails because they need to use them to survive on a daily basis because of the environments they live in. Humans have evolved away from tails because of lack of necessity.
c. The common ancestor shared between humans and monkeys (and similar primates) is a type of primate that lived before humans existed. These two groups are within the same species of mammal, so their last closest link is fairly recent when compared to other animals with shared homologous traits.
d. Refer to pictures below
2. a. An example of an analogous trait would be fins, which exist on fish such as sharks as well as birds like penguins. These fins, which serve the same universal purpose, are not necessarily linked because the two species are related to one another directly.
b. The fins on birds like penguins allow the birds to move from place to place on icy surfaces, as they have to slide to travel and these fins increase their ability to do so. Fish use their fins to swim through water, so in this way both species use their fins as means of transformation. Both penguins and fish have these fins as their arms, meaning that they are vital to their survival in their respective environments.
c. I could not find a species that traced back to the relationship between penguins and fish, but evidently the species had to have had fins and obviously lived in a water environment.
d. Refer to picture
Thursday, September 4, 2014
DNA Secret Message
I commend whoever is bold enough to decode my secret message. May it enlighten you and fill you with hope for a brighter tomorrow.
CAGTTACGAACGCAACCTCTAAACAAGTACGTCTATCTGCA
CAGTTACGAACGCAACCTCTAAACAAGTACGTCTATCTGCA
Subscribe to:
Posts (Atom)







